*ncbi.life
			The Human Reference Genome

  Source:		https://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.38
  Download:	https://ftp.ncbi.nih.gov/genomes/H_sapiens/CHR_MT

    		Mitochondrion complete genome
     
			GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATAACAATTGAATGTCTGCACAGCCACTTTCCACACAGACATCATAACAAAAAATTTCCACCAAACCCCCCCTCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTTTATCTTTTGGCGGTATGCACTTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCATACTACTAATCTCATCAATACAACCCCCGCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCATACCCCGAACCAACCAAACCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCTCCTCAAAGCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCAAGCATCCCCGTTCCAGTGAGTTCACCCTCTAAATCACCACGATCAAAAGGAACAAGCATCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGCGGTCACACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCCCCTCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACATATCTGAACACACAATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATGCTTAGCCCTAAACCTCAACAGTTAAATCAACAAAACTGCTCGCCAGAACACTACGAGCCACAGCTTAAAACTCAAAGGACCTGGCGGTGCTTCATATCCCTCTAGAGGAGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGCTCAGCCTATATACCGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGTAAGCGCAAGTACCCACGTAAAGACGTTAGGTCAAGGTGTAGCCCATGAGGTGGCAAGAAATGGGCTACATTTTCTACCCCAGAAAACTACGATAGCCCTTATGAAACTTAAGGGTCGAAGGTGGATTTAGCAGTAAACTAAGAGTAGAGTGCTTAGTTGAACAGGGCCCTGAAGCGCGTACACACCGCCCGTCACCCTCCTCAAGTATACTTCAAAGGACATTTAACTAAAACCCCTACGCATTTATATAGAGGAGACAAGTCGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAACCAGAGTGTAGCTTAACACAAAGCACCCAACTTACACTTAGGAGATTTCAACTTAACTTGACCGCTCTGAGCTAAACCTAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTTAGCCAAACCATTTACCCAAATAAAGTATAGGCGATAGAAATTGAAACCTGGCGCAATAGATATAGTACCGCAAGGGAAAGATGAAAAATTATAACCAAGCATAATATAGCAAGGACTAACCCCTATACCTTCTGCATAATGAATTAACTAGAAATAACTTTGCAAGGAGAGCCAAAGCTAAGACCCCCGAAACCAGACGAGCTACCTAAGAACAGCTAAAAGAGCACACCCGTCTATGTAGCAAAATAGTGGGAAGATTTATAGGTAGAGGCGACAAACCTACCGAGCCTGGTGATAGCTGGTTGTCCAAGATAGAATCTTAGTTCAACTTTAAATTTGCCCACAGAACCCTCTAAATCCCCTTGTAAATTTAACTGTTAGTCCAAAGAGGAACAGCTCTTTGGACACTAGGAAAAAACCTTGTAGAGAGAGTAAAAAATTTAACACCCATAGTAGGCCTAAAAGCAGCCACCAATTAAGAAAGCGTTCAAGCTCAACACCCACTACCTAAAAAATCCCAAACATATAACTGAACTCCTCACACCCAATTGGACCAATCTATCACCCTATAGAAGAACTAATGTTAGTATAAGTAACATGAAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTAAAACACTGAACTGACAATTAACAGCCCAATATCTACAATCAACCAACAAGTCATTATTACCCTCACTGTCAACCCAACACAGGCATGCTCATAAGGAAAGGTTAAAAAAAGTAAAAGGAACTCGGCAAATCTTACCCCGCCTGTTTACCAAAAACATCACCTCTAGCATCACCAGTATTAGAGGCACCGCCTGCCCAGTGACACATGTTTAACGGCCGCGGTACCCTAACCGTGCAAAGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCTCCACGAGGGTTCAGCTGTCTCTTACTTTTAACCAGTGAAATTGACCTGCCCGTGAAGAGGCGGGCATAACACAGCAAGACGAGAAGACCCTATGGAGCTTTAATTTATTAATGCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCATTAAAAATTTCGGTTGGGGCGACCTCGGAGCAGAACCCAACCTCCGAGCAGTACATGCTAAGACTTCACCAGTCAAAGCGAACTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCTAGAGTCCATATCAACAATAGGGTTTACGACCTCGATGTTGGATCAGGACATCCCGATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTACNTTCAAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGGGTTTGTTAAGATGGCAGAGCCCGGTAATCGCATAAAACTTAAAACTTTACAGTCAGAGGTTCAATTCCTCTTCTTAACAACATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAACGTTGTAGGCCCCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCTCTCACCATCGCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACCTCAACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACTCAATCCTCTGATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACTGCGAGCAGTAGCCCAAACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTATCAACATTACTAATAAGTGGCTCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACTCCTGCCATCATGACCCTTGGCCATAATATGATTTATCTCCACACTAGCAGAGACCAACCGAACCCCCTTCGACCTTGCCGAAGGGGAGTCCGAACTAGTCTCAGGCTTCAACATCGAATACGCCGCAGGCCCCTTCGCCCTATTCTTCATAGCCGAATACACAAACATTATTATAATAAACACCCTCACCACTACAATCTTCCTAGGAACAACATATGACGCACTCTCCCCTGAACTCTACACAACATATTTTGTCACCAAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCCCCGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTCACCCTAGCATTACTTATATGATATGTCTCCATACCCATTACAATCTCCAGCATTCCCCCTCAAACCTAAGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGGAGCTTAAACCCCCTTATTTCTAGGACTATGAGAATCGAACCCATCCCTGAGAATCCAAAATTCTCCGTGCCACCTATCACACCCCATCCTAAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGTTGGTTATACCCTTCCCGTACTAATTAATCCCCTGGCCCAACCCGTCATCTACTCTACCATCTTTGCAGGCACACTCATCACAGCGCTAAGCTCGCACTGATTTTTTACCTGAGTAGGCCTAGAAATAAACATGCTAGCTTTTATTCCAGTTCTAACCAAAAAAATAAACCCTCGTTCCACAGAAGCTGCCATCAAGTATTTCCTCACGCAAGCAACCGCATCCATAATCCTTCTAATAGCTATCCTCTTCAACAATATACTCTCCGGACAATGAACCATAACCAATACTACCAATCAATACTCATCATTAATAATCATAATAGCTATAGCAATAAAACTAGGAATAGCCCCCTTTCACTTCTGAGTCCCAGAGGTTACCCAAGGCACCCCTCTGACATCCGGCCTGCTTCTTCTCACATGACAAAAACTAGCCCCCATCTCAATCATATACCAAATCTCTCCCTCACTAAACGTAAGCCTTCTCCTCACTCTCTCAATCTTATCCATCATAGCAGGCAGTTGAGGTGGATTAAACCAAACCCAGCTACGCAAAATCTTAGCATACTCCTCAATTACCCACATAGGATGAATAATAGCAGTTCTACCGTACAACCCTAACATAACCATTCTTAATTTAACTATTTATATTATCCTAACTACTACCGCATTCCTACTACTCAACTTAAACTCCAGCACCACGACCCTACTACTATCTCGCACCTGAAACAAGCTAACATGACTAACACCCTTAATTCCATCCACCCTCCTCTCCCTAGGAGGCCTGCCCCCGCTAACCGGCTTTTTGCCCAAATGGGCCATTATCGAAGAATTCACAAAAAACAATAGCCTCATCATCCCCACCATCATAGCCACCATCACCCTCCTTAACCTCTACTTCTACCTACGCCTAATCTACTCCACCTCAATCACACTACTCCCCATATCTAACAACGTAAAAATAAAATGACAGTTTGAACATACAAAACCCACCCCATTCCTCCCCACACTCATCGCCCTTACCACGCTACTCCTACCTATCTCCCCTTTTATACTAATAATCTTATAGAAATTTAGGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGTAACAGCTAAGGACTGCAAAACCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTTAATTAAGCTAAGCCCTTACTAGACCAATGGGACTTAAACCCACAAACACTTAGTTAACAGCTAAGCACCCTAATCAACTGGCTTCAATCTACTTCTCCCGCCGCCGGGAAAAAAGGCGGGAGAAGCCCCGGCAGGTTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAATCACCTCGGAGCTGGTAAAAAGAGGCCTAACCCCTGTCTTTAGATTTACAGTCCAATGCTTCACTCAGCCATTTTACCTCACCCCCACTGATGTTCGCCGACCGTTGACTATTCTCTACAAACCACAAAGACATTGGAACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCTCTAAGCCTCCTTATTCGAGCCGAGCTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCACATCTACAACGTTATCGTCACAGCCCATGCATTTGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGCTTTGGCAACTGACTAGTTCCCCTAATAATCGGTGCCCCCGATATGGCGTTTCCCCGCATAAACAACATAAGCTTCTGACTCTTACCTCCCTCTCTCCTACTCCTGCTCGCATCTGCTATAGTGGAGGCCGGAGCAGGAACAGGTTGAACAGTCTACCCTCCCTTAGCAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTACACCTAGCAGGTGTCTCCTCTATCTTAGGGGCCATCAATTTCATCACAACAATTATCAATATAAAACCCCCTGCCATAACCCAATACCAAACGCCCCTCTTCGTCTGATCCGTCCTAATCACAGCAGTCCTACTTCTCCTATCTCTCCCAGTCCTAGCTGCTGGCATCACTATACTACTAACAGACCGCAACCTCAACACCACCTTCTTCGACCCCGCCGGAGGAGGAGACCCCATTCTATACCAACACCTATTCTGATTTTTCGGTCACCCTGAAGTTTATATTCTTATCCTACCAGGCTTCGGAATAATCTCCCATATTGTAACTTACTACTCCGGAAAAAAAGAACCATTTGGATACATAGGTATGGTCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATATATTTACAGTAGGAATAGACGTAGACACACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCACACTCCACGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACTACGTTGTAGCCCACTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATCATAGGAGGCTTCATTCACTGATTTCCCCTATTCTCAGGCTACACCCTAGACCAAACCTACGCCAAAATCCATTTCACTATCATATTCATCGGCGTAAATCTAACTTTCTTCCCACAACACTTTCTCGGCCTATCCGGAATGCCCCGACGTTACTCGGACTACCCCGATGCATACACCACATGAAACATCCTATCATCTGTAGGCTCATTCATTTCTCTAACAGCAGTAATATTAATAATTTTCATGATTTGAGAAGCCTTCGCTTCGAAGCGAAAAGTCCTAATAGTAGAAGAACCCTCCATAAACCTGGAGTGACTATATGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTATACATAAAATCTAGACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAACCCCATGGCCTCCATGACTTTTTCAAAAAGGTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAATTATAGGCTAAATCCTATATATCTTAATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACTTCCCCTATCATAGAAGAGCTTATCACCTTTCATGATCACGCCCTCATAATCATTTTCCTTATCTGCTTCCTAGTCCTGTATGCCCTTTTCCTAACACTCACAACAAAACTAACTAATACTAACATCTCAGACGCTCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCTAGTCCTCATCGCCCTCCCATCCCTACGCATCCTTTACATAACAGACGAGGTCAACGATCCCTCCCTTACCATCAAATCAATTGGCCACCAATGGTACTGAACCTACGAGTACACCGACTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCATTATTCCTAGAACCAGGCGACCTGCGACTCCTTGACGTTGACAATCGAGTAGTACTCCCGATTGAAGCCCCCATTCGTATAATAATTACATCACAAGACGTCTTGCACTCATGAGCTGTCCCCACATTAGGCTTAAAAACAGATGCAATTCCCGGACGTCTAAACCAAACCACTTTCACCGCTACACGACCGGGGGTATACTACGGTCAATGCTCTGAAATCTGTGGAGCAAACCACAGTTTCATGCCCATCGTCCTAGAATTAATTCCCCTAAAAATCTTTGAAATAGGGCCCGTATTTACCCTATAGCACCCCCTCTACCCCCTCTAGAGCCCACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTTAAAGATTAAGAGAACCAACACCTCTTTACAGTGAAATGCCCCAACTAAATACTACCGTATGGCCCACCATAATTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAAAAATATTAAACACAAACTACCACCTACCTCCCTCACCAAAGCCCATAAAAATAAAAAATTATAACAAACCCTGAGAACCAAAATGAACGAAAATCTGTTCGCTTCATTCATTGCCCCCACAATCCTAGGCCTACCCGCCGCAGTACTGATCATTCTATTTCCCCCTCTATTGATCCCCACCTCCAAATATCTCATCAACAACCGACTAATCACCACCCAACAATGACTAATCAAACTAACCTCAAAACAAATGATAACCATACACAACACTAAAGGACGAACCTGATCTCTTATACTAGTATCCTTAATCATTTTTATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACACCAACCACCCAACTATCTATAAACCTAGCCATGGCCATCCCCTTATGAGCGGGCACAGTGATTATAGGCTTTCGCTCTAAGATTAAAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTACACCCCTTATCCCCATACTAGTTATTATCGAAACCATCAGCCTACTCATTCAACCAATAGCCCTGGCCGTACGCCTAACCGCTAACATTACTGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCACCCTAGCAATATCAACCATTAACCTTCCCTCTACACTTATCATCTTCACAATTCTAATTCTACTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCACACTTCTAGTAAGCCTCTACCTGCACGACAACACATAATGACCCACCAATCACATGCCTATCATATAGTAAAACCCAGCCCATGACCCCTAACAGGGGCCCTCTCAGCCCTCCTAATGACCTCCGGCCTAGCCATGTGATTTCACTTCCACTCCATAACGCTCCTCATACTAGGCCTACTAACCAACACACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACCACCTGTCCAAAAAGGCCTTCGATACGGGATAATCCTATTTATTACCTCAGAAGTTTTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAGCCTAGCCCCTACCCCCCAATTAGGAGGGCACTGGCCCCCAACAGGCATCACCCCGCTAAATCCCCTAGAAGTCCCACTCCTAAACACATCCGTATTACTCGCATCAGGAGTATCAATCACCTGAGCTCACCATAGTCTAATAGAAAACAACCGAAACCAAATAATTCAAGCACTGCTTATTACAATTTTACTGGGTCTCTATTTTACCCTCCTACAAGCCTCAGAGTACTTCGAGTCTCCCTTCACCATTTCCGACGGCATCTACGGCTCAACATTTTTTGTAGCCACAGGCTTCCACGGACTTCACGTCATTATTGGCTCAACTTTCCTCACTATCTGCTTCATCCGCCAACTAATATTTCACTTTACATCCAAACATCACTTTGGCTTCGAAGCCGCCGCCTGATACTGGCATTTTGTAGATGTGGTTTGACTATTTCTGTATGTCTCCATCTATTGATGAGGGTCTTACTCTTTTAGTATAAATAGTACCGTTAACTTCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTAATAAACTTCGCCTTAATTTTAATAATCAACACCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACTCAACGGCTACATAGAAAAATCCACCCCTTACGAGTGCGGCTTCGACCCTATATCCCCCGCCCGCGTCCCTTTCTCCATAAAATTCTTCTTAGTAGCTATTACCTTCTTATTATTTGATCTAGAAATTGCCCTCCTTTTACCCCTACCATGAGCCCTACAAACAACTAACCTGCCACTAATAGTTATGTCATCCCTCTTATTAATCATCATCCTAGCCCTAAGTCTGGCCTATGAGTGACTACAAAAAGGATTAGACTGAACCGAATTGGTATATAGTTTAAACAAAACGAATGATTTCGACTCATTAAATTATGATAATCATATTTACCAAATGCCCCTCATTTACATAAATATTATACTAGCATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATATCCTCCCTACTATGCCTAGAAGGAATAATACTATCGCTGTTCATTATAGCTACTCTCATAACCCTCAACACCCACTCCCTCTTAGCCAATATTGTGCCTATTGCCATACTAGTCTTTGCCGCCTGCGAAGCAGCGGTGGGCCTAGCCCTACTAGTCTCAATCTCCAACACATATGGCCTAGACTACGTACATAACCTAAACCTACTCCAATGCTAAAACTAATCGTCCCAACAATTATATTACTACCACTGACATGACTTTCCAAAAAACACATAATTTGAATCAACACAACCACCCACAGCCTAATTATTAGCATCATCCCTCTACTATTTTTTAACCAAATCAACAACAACCTATTTAGCTGTTCCCCAACCTTTTCCTCCGACCCCCTAACAACCCCCCTCCTAATACTAACTACCTGACTCCTACCCCTCACAATCATGGCAAGCCAACGCCACTTATCCAGTGAACCACTATCACGAAAAAAACTCTACCTCTCTATACTAATCTCCCTACAAATCTCCTTAATTATAACATTCACAGCCACAGAACTAATCATATTTTATATCTTCTTCGAAACCACACTTATCCCCACCTTGGCTATCATCACCCGATGAGGCAACCAGCCAGAACGCCTGAACGCAGGCACATACTTCCTATTCTACACCCTAGTAGGCTCCCTTCCCCTACTCATCGCACTAATTTACACTCACAACACCCTAGGCTCACTAAACATTCTACTACTCACTCTCACTGCCCAAGAACTATCAAACTCCTGAGCCAACAACTTAATATGACTAGCTTACACAATAGCTTTTATAGTAAAGATACCTCTTTACGGACTCCACTTATGACTCCCTAAAGCCCATGTCGAAGCCCCCATCGCTGGGTCAATAGTACTTGCCGCAGTACTCTTAAAACTAGGCGGCTATGGTATAATACGCCTCACACTCATTCTCAACCCCCTGACAAAACACATAGCCTACCCCTTCCTTGTACTATCCCTATGAGGCATAATTATAACAAGCTCCATCTGCCTACGACAAACAGACCTAAAATCGCTCATTGCATACTCTTCAATCAGCCACATAGCCCTCGTAGTAACAGCCATTCTCATCCAAACCCCCTGAAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGCCTAGCAAACTCAAACTACGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCACTAATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTCCTGATCAAATATCACTCTCCTACTTACAGGACTCAACATACTAGTCACAGCCCTATACTCCCTCTACATATTTACCACAACACAATGGGGCTCACTCACCCACCACATTAACAACATAAAACCCTCATTCACACGAGAAAACACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCTATCCCTCAACCCCGACATCATTACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGACAACAGAGGCTTACGACCCCTTATTTACCGAGAAAGCTCACAAGAACTGCTAACTCATGCCCCCATGTCTAACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTAGGCCCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACCATGCACACTACTATAACCACCCTAACCCTGACTTCCCTAATTCCCCCCATCCTTACCACCCTCGTTAACCCTAACAAAAAAAACTCATACCCCCATTATGTAAAATCCATTGTCGCATCCACCTTTATTATCAGTCTCTTCCCCACAACAATATTCATGTGCCTAGACCAAGAAGTTATTATCTCGAACTGACACTGAGCCACAACCCAAACAACCCAGCTCTCCCTAAGCTTCAAACTAGACTACTTCTCCATAATATTCATCCCTGTAGCATTGTTCGTTACATGGTCCATCATAGAATTCTCACTGTGATATATAAACTCAGACCCAAACATTAATCAGTTCTTCAAATATCTACTCATCTTCCTAATTACCATACTAATCTTAGTTACCGCTAACAACCTATTCCAACTGTTCATCGGCTGAGAGGGCGTAGGAATTATATCCTTCTTGCTCATCAGTTGATGATACGCCCGAGCAGATGCCAACACAGCAGCCATTCAAGCAATCCTATACAACCGTATCGGCGATATCGGTTTCATCCTCGCCTTAGCATGATTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAAACGCTAATCCAAGCCTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAATTAGGTCTCCACCCCTGACTCCCCTCAGCCATAGAAGGCCCCACCCCAGTCTCAGCCCTACTCCACTCAAGCACTATAGTTGTAGCAGGAATCTTCTTACTCATCCGCTTCCACCCCCTAGCAGAAAATAGCCCACTAATCCAAACTCTAACACTATGCTTAGGCGCTATCACCACTCTGTTCGCAGCAGTCTGCGCCCTTACACAAAATGACATCAAAAAAATCGTAGCCTTCTCCACTTCAAGTCAACTAGGACTCATAATAGTTACAATCGGCATCAACCAACCACACCTAGCATTCCTGCACATCTGTACCCACGCCTTCTTCAAAGCCATACTATTTATGTGCTCCGGGTCCATCATCCACAACCTTAACAATGAACAAGATATTCGAAAAATAGGAGGACTACTCAAAACCATACCTCTCACTTCAACCTCCCTCACCATTGGCAGCCTAGCATTAGCAGGAATACCTTTCCTCACAGGTTTCTACTCCAAAGACCACATCATCGAAACCGCAAACATATCATACACAAACGCCTGAGCCCTATCTATTACTCTCATCGCTACCTCCCTGACAAGCGCCTATAGCACTCGAATAATTCTTCTCACCCTAACAGGTCAACCTCGCTTCCCCACCCTTACTAACATTAACGAAAATAACCCCACCCTACTAAACCCCATTAAACGCCTGGCAGCCGGAAGCCTATTCGCAGGATTTCTCATTACTAACAACATTTCCCCCGCATCCCCCTTCCAAACAACAATCCCCCTCTACCTAAAACTCACAGCCCTCGCTGTCACTTTCCTAGGACTTCTAACAGCCCTAGACCTCAACTACCTAACCAACAAACTTAAAATAAAATCCCCACTATGCACATTTTATTTCTCCAACATACTCGGATTCTACCCTAGCATCACACACCGCACAATCCCCTATCTAGGCCTTCTTACGAGCCAAAACCTGCCCCTACTCCTCCTAGACCTAACCTGACTAGAAAAGCTATTACCTAAAACAATTTCACAGCACCAAATCTCCACCTCCATCATCACCTCAACCCAAAAAGGCATAATTAAACTTTACTTCCTCTCTTTCTTCTTCCCACTCATCCTAACCCTACTCCTAATCACATAACCTATTCCCCCGAGCAATCTCAATTACAATATATACACCAACAAACAATGTTCAACCAGTAACTACTACTAATCAACGCCCATAATCATACAAAGCCCCCGCACCAATAGGATCCTCCCGAATCAACCCTGACCCCTCTCCTTCATAAATTATTCAGCTTCCTACACTATTAAAGTTTACCACAACCACCACCCCATCATACTCTTTCACCCACAGCACCAATCCTACCTCCATCGCTAACCCCACTAAAACACTCACCAAGACCTCAACCCCTGACCCCCATGCCTCAGGATACTCCTCAATAGCCATCGCTGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATAAATTAAAAAAACTATTAAACCCATATAACCTCCCCCAAAATTCAGAATAATAACACACCCGACCACACCGCTAACAATCAATACTAAACCCCCATAAATAGGAGAAGGCTTAGAAGAAAACCCCACAAACCCCATTACTAAACCCACACTCAACAGAAACAAAGCATACATCATTATTCTCGCACGGACTACAACCACGACCAATGATATGAAAAACCATCGTTGTATTTCAACTACAAGAACACCAATGACCCCAATACGCAAAACTAACCCCCTAATAAAATTAATTAACCACTCATTCATCGACCTCCCCACCCCATCCAACATCTCCGCATGATGAAACTTCGGCTCACTCCTTGGCGCCTGCCTGATCCTCCAAATCACCACAGGACTATTCCTAGCCATGCACTACTCACCAGACGCCTCAACCGCCTTTTCATCAATCGCCCACATCACTCGAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCCTATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATCCTCCTGCTTGCAACTATAGCAACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTCTGAGGGGCCACAGTAATTACAAACTTACTATCCGCCATCCCATACATTGGGACAGACCTAGTTCAATGAATCTGAGGAGGCTACTCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTCACTTCATCTTGCCCTTCATTATTGCAGCCCTAGCAACACTCCACCTCCTATTCTTGCACGAAACGGGATCAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATCACCTTCCACCCTTACTACACAATCAAAGACGCCCTCGGCTTACTTCTCTTCCTTCTCTCCTTAATGACATTAACACTATTCTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTAGCCAACCCCTTAAACACCCCTCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTCCCTAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAGCAATAATCCCCATCCTCCATATATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCCAATCACTTTATTGACTCCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGACAACCAGTAAGCTACCCTTTTACCATCATTGGACAAGTAGCATCCGTACTATACTTCACAACAATCCTAATCCTAATACCAACTATCTCCCTAATTGAAAACAAAATACTCAAATGGGCCTGTCCTTGTAGTATAAACTAATACACCAGTCTTGTAAACCGGAGATGAAAACCTTTTTCCAAGGACAAATCAGAGAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAAGATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATG  

			Summary
			Mitochondria generate adenosine triphosphate
			(ATP), vital to all types of human cells, especially
			those that require large amounts of energy.

			Mitochondria have their own circular DNA
			consisting of 16,569 base pairs and 37 genes.
			Each mitochondrion contains multiple copies
			of its own genome. Many mitochondrial genes
			have been transferred to the nuclear genome,
			which now encodes most proteins composing
			the mitochondria (PMID: 29628043, 29032101,
			24859348, 23143808, 22424226). Phylogenetic
			analyses on heat shock proteins HSPA1A, HSPD1
			and HSPE1 have confirmed that mitochondria are
			endosymbiotic descendants of α-Gram-negative
			purple bacteria (PMID: 25609566, 25432941,
			24591518, 8790385, 2831186).

			Related Genes
			3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2)
			3-hydroxybutyrate dehydrogenase 1 (BDH1)
			3-hydroxyisobutyrate dehydrogenase (HIBADH)
			3-hydroxymethyl-3-methylglutaryl-CoA lyase (HMGCL)
			3-oxoacid CoA-transferase 1 (OXCT1)
			3-oxoacid CoA-transferase 2 (OXCT2)
			3-oxoacyl-ACP synthase, mitochondrial (OXSM)
			4-hydroxy-2-oxoglutarate aldolase 1 (HOGA1)
			5',3'-nucleotidase, mitochondrial (NT5M)
			5'-aminolevulinate synthase 1 (ALAS1)
			5'-aminolevulinate synthase 2 (ALAS2)
			5-phosphohydroxy-L-lysine phospho-lyase (PHYKPL)
			8-oxoguanine DNA glycosylase (OGG1)
			A-kinase anchoring protein 1 (AKAP1)
			A-kinase anchoring protein 10 (AKAP10)
			ADP-ribosylhydrolase like 2 (ADPRHL2)
			AFG1 like ATPase (AFG1L)
			AFG3 like matrix AAA peptidase subunit 2 (AFG3L2)
			ATP binding cassette subfamily B member 10 (ABCB10)
			ATP binding cassette subfamily B member 7 (ABCB7)
			ATP binding cassette subfamily B member 8 (ABCB8)
			ATP synthase inhibitory factor subunit 1 (ATP5IF1)
			ATP synthase membrane subunit f (ATP5MF)
			ATP synthase peripheral stalk subunit OSCP (ATP5PO)
			ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B) (ATP5S)
			ATP23 metallopeptidase and ATP synthase assembly factor homolog (ATP23)
			ATP5MF-PTCD1 readthrough (ATP5MF-PTCD1)
			ATPase family, AAA domain containing 3A (ATAD3A)
			ATPase family, AAA domain containing 3B (ATAD3B)
			AU RNA binding methylglutaconyl-CoA hydratase (AUH)
			BCL2 antagonist/killer 1 (BAK1)
			BCL2 associated X, apoptosis regulator (BAX)
			BCL2 binding component 3 (BBC3)
			BCL2 interacting protein 3 (BNIP3)
			BCL2 interacting protein 3 like (BNIP3L)
			BCL2 like 1 (BCL2L1)
			BCL2 like 10 (BCL2L10)
			BCL2 like 13 (BCL2L13)
			BCL2 related protein A1 (BCL2A1)
			BCL2, apoptosis regulator (BCL2)
			BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone (BCS1L)
			BH3 interacting domain death agonist (BID)
			BH3-like motif containing, cell death inducer (BLID)
			C-X9-C motif containing 4 (CMC4)
			CDGSH iron sulfur domain 1 (CISD1)
			CDP-diacylglycerol synthase 1 (CDS1)
			CDP-diacylglycerol synthase 2 (CDS2)
			COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor (COX10)
			COX11, cytochrome c oxidase copper chaperone (COX11)
			COX14, cytochrome c oxidase assembly factor (COX14)
			COX15, cytochrome c oxidase assembly homolog (COX15)
			COX17, cytochrome c oxidase copper chaperone (COX17)
			COX18, cytochrome c oxidase assembly factor (COX18)
			COX19, cytochrome c oxidase assembly factor (COX19)
			COX20, cytochrome c oxidase assembly factor (COX20)
			CREB regulated transcription coactivator 3 (CRTC3)
			D-2-hydroxyglutarate dehydrogenase (D2HGDH)
			D-amino acid oxidase activator (DAOA)
			DDHD domain containing 1 (DDHD1)
			DEAD-box helicase 1 (DDX1)
			DEAD-box helicase 10 (DDX10)
			DEAD-box helicase 17 (DDX17)
			DEAD-box helicase 18 (DDX18)
			DEAD-box helicase 19B (DDX19B)
			DEAD-box helicase 20 (DDX20)
			DEAD-box helicase 23 (DDX23)
			DEAD-box helicase 24 (DDX24)
			DEAD-box helicase 25 (DDX25)
			DEAD-box helicase 27 (DDX27)
			DEAD-box helicase 28 (DDX28)
			DEAD-box helicase 31 (DDX31)
			DEAD-box helicase 4 (DDX4)
			DEAD-box helicase 41 (DDX41)
			DEAD-box helicase 42 (DDX42)
			DEAD-box helicase 46 (DDX46)
			DEAD-box helicase 47 (DDX47)
			DEAD-box helicase 54 (DDX54)
			DEAD-box helicase 55 (DDX55)
			DEAD-box helicase 56 (DDX56)
			DEAD/H-box helicase 11 (DDX11)
			DEAH-box helicase 16 (DHX16)
			DEAH-box helicase 32 (putative) (DHX32)
			DEAH-box helicase 33 (DHX33)
			DEAH-box helicase 35 (DHX35)
			DEAH-box helicase 37 (DHX37)
			DEAH-box helicase 38 (DHX38)
			DExD-box helicase 21 (DDX21)
			DExD-box helicase 39A (DDX39A)
			DExD-box helicase 50 (DDX50)
			DExH-box helicase 30 (DHX30)
			DExH-box helicase 34 (DHX34)
			DISC1 scaffold protein (DISC1)
			DNA ligase 3 (LIG3)
			DNA polymerase gamma 2, accessory subunit (POLG2)
			DNA polymerase gamma, catalytic subunit (POLG)
			DNA replication helicase/nuclease 2 (DNA2)
			DNA topoisomerase I mitochondrial (TOP1MT)
			DnaJ heat shock protein family (Hsp40) member A2 (DNAJA2)
			DnaJ heat shock protein family (Hsp40) member A3 (DNAJA3)
			DnaJ heat shock protein family (Hsp40) member C19 (DNAJC19)
			EF-hand domain family member D1 (EFHD1)
			EI24, autophagy associated transmembrane protein (EI24)
			ERCC excision repair 6 like 2 (ERCC6L2)
			ETHE1, persulfide dioxygenase (ETHE1)
			Era like 12S mitochondrial rRNA chaperone 1 (ERAL1)
			FAD dependent oxidoreductase domain containing 1 (FOXRED1)
			FAST kinase domains 2 (FASTKD2)
			FAST kinase domains 3 (FASTKD3)
			G elongation factor mitochondrial 1 (GFM1)
			G elongation factor mitochondrial 2 (GFM2)
			G protein-coupled receptor kinase 2 (GRK2)
			GA binding protein transcription factor subunit alpha (GABPA)
			GA binding protein transcription factor subunit beta 1 (GABPB1)
			GRAM domain containing 4 (GRAMD4)
			GTP binding protein 3, mitochondrial (GTPBP3)
			GUF1 homolog, GTPase (GUF1)
			HCLS1 associated protein X-1 (HAX1)
			HIG1 hypoxia inducible domain family member 2A (HIGD2A)
			HscB mitochondrial iron-sulfur cluster cochaperone (HSCB)
			HtrA serine peptidase 2 (HTRA2)
			IBA57, iron-sulfur cluster assembly (IBA57)
			KIF1 binding protein (KIF1BP)
			LETM1 domain containing 1 (LETMD1)
			LYR motif containing 1 (LYRM1)
			LYR motif containing 4 (LYRM4)
			LYR motif containing 7 (LYRM7)
			MPV17, mitochondrial inner membrane protein (MPV17)
			McKusick-Kaufman syndrome (MKKS)
			N-acetylglutamate synthase (NAGS)
			NAD kinase 2, mitochondrial (NADK2)
			NADH:ubiquinone oxidoreductase complex assembly factor 1 (NDUFAF1)
			NADH:ubiquinone oxidoreductase complex assembly factor 2 (NDUFAF2)
			NADH:ubiquinone oxidoreductase complex assembly factor 3 (NDUFAF3)
			NADH:ubiquinone oxidoreductase complex assembly factor 4 (NDUFAF4)
			NADH:ubiquinone oxidoreductase complex assembly factor 5 (NDUFAF5)
			NADH:ubiquinone oxidoreductase complex assembly factor 6 (NDUFAF6)
			NADH:ubiquinone oxidoreductase complex assembly factor 7 (NDUFAF7)
			NADH:ubiquinone oxidoreductase core subunit S1 (NDUFS1)
			NADH:ubiquinone oxidoreductase core subunit S2 (NDUFS2)
			NADH:ubiquinone oxidoreductase core subunit S3 (NDUFS3)
			NADH:ubiquinone oxidoreductase core subunit S7 (NDUFS7)
			NADH:ubiquinone oxidoreductase core subunit S8 (NDUFS8)
			NADH:ubiquinone oxidoreductase core subunit V1 (NDUFV1)
			NADH:ubiquinone oxidoreductase core subunit V2 (NDUFV2)
			NADH:ubiquinone oxidoreductase subunit A1 (NDUFA1)
			NADH:ubiquinone oxidoreductase subunit A10 (NDUFA10)
			NADH:ubiquinone oxidoreductase subunit A11 (NDUFA11)
			NADH:ubiquinone oxidoreductase subunit A12 (NDUFA12)
			NADH:ubiquinone oxidoreductase subunit A13 (NDUFA13)
			NADH:ubiquinone oxidoreductase subunit A2 (NDUFA2)
			NADH:ubiquinone oxidoreductase subunit A5 (NDUFA5)
			NADH:ubiquinone oxidoreductase subunit A6 (NDUFA6)
			NADH:ubiquinone oxidoreductase subunit A7 (NDUFA7)
			NADH:ubiquinone oxidoreductase subunit A9 (NDUFA9)
			NADH:ubiquinone oxidoreductase subunit B11 (NDUFB11)
			NADH:ubiquinone oxidoreductase subunit B3 (NDUFB3)
			NADH:ubiquinone oxidoreductase subunit B4 (NDUFB4)
			NADH:ubiquinone oxidoreductase subunit B5 (NDUFB5)
			NADH:ubiquinone oxidoreductase subunit B6 (NDUFB6)
			NADH:ubiquinone oxidoreductase subunit B7 (NDUFB7)
			NADH:ubiquinone oxidoreductase subunit B9 (NDUFB9)
			NADH:ubiquinone oxidoreductase subunit C1 (NDUFC1)
			NADH:ubiquinone oxidoreductase subunit S4 (NDUFS4)
			NADH:ubiquinone oxidoreductase subunit S5 (NDUFS5)
			NADH:ubiquinone oxidoreductase subunit S6 (NDUFS6)
			NADH:ubiquinone oxidoreductase subunit V3 (NDUFV3)
			NDUFA4, mitochondrial complex associated (NDUFA4)
			NFS1, cysteine desulfurase (NFS1)
			NFU1 iron-sulfur cluster scaffold (NFU1)
			NLR family member X1 (NLRX1)
			OPA1, mitochondrial dynamin like GTPase (OPA1)
			OPA3, outer mitochondrial membrane lipid metabolism regulator (OPA3)
			OXA1L, mitochondrial inner membrane protein (OXA1L)
			PET100 homolog (PET100)
			PIF1 5'-to-3' DNA helicase (PIF1)
			POP1 homolog, ribonuclease P/MRP subunit (POP1)
			POP4 homolog, ribonuclease P/MRP subunit (POP4)
			PPARG coactivator 1 alpha (PPARGC1A)
			PRELI domain containing 1 (PRELID1)
			PTEN induced putative kinase 1 (PINK1)
			RAB32, member RAS oncogene family (RAB32)
			REV3 like, DNA directed polymerase zeta catalytic subunit (REV3L)
			RNA component of mitochondrial RNA processing endoribonuclease (RMRP)
			RNA polymerase mitochondrial (POLRMT)
			RNA pseudouridylate synthase domain containing 3 (RPUSD3)
			SAMM50 sorting and assembly machinery component (SAMM50)
			SCO1, cytochrome c oxidase assembly protein (SCO1)
			SCO2, cytochrome c oxidase assembly protein (SCO2)
			SH3 domain containing GRB2 like, endophilin B1 (SH3GLB1)
			SHC adaptor protein 1 (SHC1)
			SLMO2-ATP5E readthrough (SLMO2-ATP5E)
			SPG7, paraplegin matrix AAA peptidase subunit (SPG7)
			SURF1, cytochrome c oxidase assembly factor (SURF1)
			Ski2 like RNA helicase (SKIV2L)
			TNF receptor associated protein 1 (TRAP1)
			Ts translation elongation factor, mitochondrial (TSFM)
			Tu translation elongation factor, mitochondrial (TUFM)
			X-prolyl aminopeptidase 3 (XPNPEP3)
			YME1 like 1 ATPase (YME1L1)
			abhydrolase domain containing 10 (ABHD10)
			acetyl-CoA acetyltransferase 1 (ACAT1)
			acetyl-CoA acyltransferase 2 (ACAA2)
			acetyl-CoA carboxylase beta (ACACB)
			aconitase 2 (ACO2)
			acyl-CoA dehydrogenase family member 10 (ACAD10)
			acyl-CoA dehydrogenase family member 8 (ACAD8)
			acyl-CoA dehydrogenase family member 9 (ACAD9)
			acyl-CoA dehydrogenase long chain (ACADL)
			acyl-CoA dehydrogenase medium chain (ACADM)
			acyl-CoA dehydrogenase short chain (ACADS)
			acyl-CoA dehydrogenase short/branched chain (ACADSB)
			acyl-CoA dehydrogenase very long chain (ACADVL)
			acyl-CoA synthetase family member 3 (ACSF3)
			acyl-CoA synthetase medium chain family member 2A (ACSM2A)
			acyl-CoA synthetase short chain family member 1 (ACSS1)
			acyl-CoA thioesterase 13 (ACOT13)
			acyl-CoA thioesterase 9 (ACOT9)
			acylglycerol kinase (AGK)
			adenylate kinase 2 (AK2)
			adenylate kinase 3 (AK3)
			adenylate kinase 4 (AK4)
			alanine--glyoxylate aminotransferase 2 (AGXT2)
			alanyl-tRNA synthetase 2, mitochondrial (AARS2)
			aldehyde dehydrogenase 1 family member A1 (ALDH1A1)
			aldehyde dehydrogenase 1 family member L2 (ALDH1L2)
			aldehyde dehydrogenase 18 family member A1 (ALDH18A1)
			aldehyde dehydrogenase 2 family member (ALDH2)
			aldehyde dehydrogenase 4 family member A1 (ALDH4A1)
			aldehyde dehydrogenase 5 family member A1 (ALDH5A1)
			aldehyde dehydrogenase 6 family member A1 (ALDH6A1)
			aldehyde dehydrogenase 7 family member A1 (ALDH7A1)
			alpha-methylacyl-CoA racemase (AMACR)
			apoptogenic 1, mitochondrial (APOPT1)
			apoptosis inducing factor mitochondria associated 1 (AIFM1)
			apurinic/apyrimidinic endodeoxyribonuclease 2 (APEX2)
			arginase 2 (ARG2)
			arginyl-tRNA synthetase 2, mitochondrial (RARS2)
			asparaginyl-tRNA synthetase 2, mitochondrial (NARS2)
			aspartyl-tRNA synthetase 2, mitochondrial (DARS2)
			ataxin 2 (ATXN2)
			autophagy related 5 (ATG5)
			bolA family member 3 (BOLA3)
			branched chain amino acid transaminase 1 (BCAT1)
			branched chain amino acid transaminase 2 (BCAT2)
			branched chain keto acid dehydrogenase E1 subunit beta (BCKDHB)
			branched chain keto acid dehydrogenase E1, alpha polypeptide (BCKDHA)
			branched chain ketoacid dehydrogenase kinase (BCKDK)
			calsequestrin 1 (CASQ1)
			carbamoyl-phosphate synthase 1 (CPS1)
			carbonic anhydrase 5A (CA5A)
			carbonic anhydrase 5B (CA5B)
			cardiolipin synthase 1 (CRLS1)
			carnitine O-acetyltransferase (CRAT)
			carnitine O-octanoyltransferase (CROT)
			carnitine palmitoyltransferase 1A (CPT1A)
			carnitine palmitoyltransferase 1B (CPT1B)
			carnitine palmitoyltransferase 1C (CPT1C)
			carnitine palmitoyltransferase 2 (CPT2)
			caseinolytic mitochondrial matrix peptidase chaperone subunit (CLPX)
			caseinolytic mitochondrial matrix peptidase proteolytic subunit (CLPP)
			choline dehydrogenase (CHDH)
			chromosome 12 open reading frame 65 (C12orf65)
			chromosome 21 open reading frame 2 (C21orf2)
			citrate synthase (CS)
			coenzyme Q2, polyprenyltransferase (COQ2)
			coenzyme Q4 (COQ4)
			coenzyme Q6, monooxygenase (COQ6)
			coenzyme Q7, hydroxylase (COQ7)
			coenzyme Q8A (COQ8A)
			coenzyme Q9 (COQ9)
			coiled-coil-helix-coiled-coil-helix domain containing 10 (CHCHD10)
			coiled-coil-helix-coiled-coil-helix domain containing 2 (CHCHD2)
			coiled-coil-helix-coiled-coil-helix domain containing 3 (CHCHD3)
			coiled-coil-helix-coiled-coil-helix domain containing 4 (CHCHD4)
			coproporphyrinogen oxidase (CPOX)
			creatine kinase, mitochondrial 1A (CKMT1A)
			creatine kinase, mitochondrial 1B (CKMT1B)
			creatine kinase, mitochondrial 2 (CKMT2)
			cysteinyl-tRNA synthetase 2, mitochondrial (CARS2)
			cytochrome P450 family 11 subfamily A member 1 (CYP11A1)
			cytochrome P450 family 11 subfamily B member 1 (CYP11B1)
			cytochrome P450 family 11 subfamily B member 2 (CYP11B2)
			cytochrome P450 family 24 subfamily A member 1 (CYP24A1)
			cytochrome P450 family 27 subfamily A member 1 (CYP27A1)
			cytochrome P450 family 27 subfamily B member 1 (CYP27B1)
			cytochrome b5 reductase 3 (CYB5R3)
			cytochrome c oxidase assembly factor 3 (COA3)
			cytochrome c oxidase assembly factor 5 (COA5)
			cytochrome c oxidase assembly factor 6 (COA6)
			cytochrome c oxidase subunit 4I1 (COX4I1)
			cytochrome c oxidase subunit 4I2 (COX4I2)
			cytochrome c oxidase subunit 5A (COX5A)
			cytochrome c oxidase subunit 5B (COX5B)
			cytochrome c oxidase subunit 6A1 (COX6A1)
			cytochrome c oxidase subunit 6A2 (COX6A2)
			cytochrome c oxidase subunit 6B1 (COX6B1)
			cytochrome c oxidase subunit 6C (COX6C)
			cytochrome c oxidase subunit 7A1 (COX7A1)
			cytochrome c oxidase subunit 7A2 (COX7A2)
			cytochrome c oxidase subunit 7A2 like (COX7A2L)
			cytochrome c oxidase subunit 7B (COX7B)
			cytochrome c oxidase subunit 7C (COX7C)
			cytochrome c oxidase subunit 8A (COX8A)
			cytochrome c oxidase subunit 8B, pseudogene (COX8BP)
			cytochrome c, somatic (CYCS)
			cytochrome c1 (CYC1)
			death associated protein 3 (DAP3)
			decaprenyl diphosphate synthase subunit 1 (PDSS1)
			dehydrogenase E1 and transketolase domain containing 1 (DHTKD1)
			deoxyguanosine kinase (DGUOK)
			deoxyuridine triphosphatase (DUT)
			diablo IAP-binding mitochondrial protein (DIABLO)
			dihydrolipoamide S-acetyltransferase (DLAT)
			dihydrolipoamide S-succinyltransferase (DLST)
			dihydrolipoamide branched chain transacylase E2 (DBT)
			dihydroorotate dehydrogenase (quinone) (DHODH)
			dimethylarginine dimethylaminohydrolase 2 (DDAH2)
			dimethylglycine dehydrogenase (DMGDH)
			dynactin subunit 6 (DCTN6)
			dynamin 1 like (DNM1L)
			electron transfer flavoprotein dehydrogenase (ETFDH)
			electron transfer flavoprotein subunit alpha (ETFA)
			electron transfer flavoprotein subunit beta (ETFB)
			endonuclease G (ENDOG)
			enolase superfamily member 1 (ENOSF1)
			enoyl-CoA delta isomerase 1 (ECI1)
			enoyl-CoA delta isomerase 2 (ECI2)
			enoyl-CoA hydratase 1 (ECH1)
			enoyl-CoA hydratase, short chain 1 (ECHS1)
			estrogen receptor 2 (ESR2)
			eukaryotic translation initiation factor 2 alpha kinase 3 (EIF2AK3)
			eukaryotic translation initiation factor 4A3 (EIF4A3)
			exo/endonuclease G (EXOG)
			family with sequence similarity 136 member A (FAM136A)
			ferredoxin 1 (FDX1)
			ferredoxin 2 (FDX2)
			ferredoxin reductase (FDXR)
			ferrochelatase (FECH)
			fission, mitochondrial 1 (FIS1)
			folylpolyglutamate synthase (FPGS)
			frataxin (FXN)
			fumarate hydratase (FH)
			gamma-butyrobetaine hydroxylase 1 (BBOX1)
			glutamate dehydrogenase 1 (GLUD1)
			glutamate dehydrogenase 2 (GLUD2)
			glutamic--pyruvic transaminase (GPT)
			glutamic--pyruvic transaminase 2 (GPT2)
			glutamic-oxaloacetic transaminase 1 (GOT1)
			glutamic-oxaloacetic transaminase 2 (GOT2)
			glutaminase (GLS)
			glutaminase 2 (GLS2)
			glutamine amidotransferase like class 1 domain containing 3A (GATD3A)
			glutaminyl-tRNA synthetase (QARS)
			glutamyl-tRNA synthetase 2, mitochondrial (EARS2)
			glutaredoxin 2 (GLRX2)
			glutaredoxin 5 (GLRX5)
			glutaryl-CoA dehydrogenase (GCDH)
			glutathione peroxidase 1 (GPX1)
			glycerol-3-phosphate acyltransferase, mitochondrial (GPAM)
			glycerol-3-phosphate dehydrogenase 1 (GPD1)
			glycerol-3-phosphate dehydrogenase 2 (GPD2)
			glycine amidinotransferase (GATM)
			glycine cleavage system protein H (GCSH)
			glycine decarboxylase (GLDC)
			glycine-N-acyltransferase (GLYAT)
			glycogen synthase kinase 3 beta (GSK3B)
			growth factor, augmenter of liver regeneration (GFER)
			heat shock protein 90 alpha family class A member 2, pseudogene (HSP90AA2P)
			heat shock protein family A (Hsp70) member 9 (HSPA9)
			heat shock protein family D (Hsp60) member 1 (HSPD1)
			heme binding protein 2 (HEBP2)
			hexokinase 1 (HK1)
			hexokinase 2 (HK2)
			hydroxyacyl-CoA dehydrogenase (HADH)
			hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha (HADHA)
			hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit beta (HADHB)
			hydroxyacyl-thioester dehydratase type 2 (HTD2)
			hydroxysteroid 17-beta dehydrogenase 10 (HSD17B10)
			hypoxia up-regulated 1 (HYOU1)
			inner mitochondrial membrane peptidase subunit 1 (IMMP1L)
			inner mitochondrial membrane peptidase subunit 2 (IMMP2L)
			inositol polyphosphate-5-phosphatase B (INPP5B)
			insulin degrading enzyme (IDE)
			interferon induced with helicase C domain 1 (IFIH1)
			iron-sulfur cluster assembly 1 (ISCA1)
			iron-sulfur cluster assembly 2 (ISCA2)
			iron-sulfur cluster assembly enzyme (ISCU)
			isocitrate dehydrogenase (NADP(+)) 1, cytosolic (IDH1)
			isocitrate dehydrogenase (NADP(+)) 2, mitochondrial (IDH2)
			isocitrate dehydrogenase 3 (NAD(+)) alpha (IDH3A)
			isocitrate dehydrogenase 3 (NAD(+)) beta (IDH3B)
			isocitrate dehydrogenase 3 (NAD(+)) gamma (IDH3G)
			isoleucyl-tRNA synthetase 2, mitochondrial (IARS2)
			isovaleryl-CoA dehydrogenase (IVD)
			kinesin family member 1B (KIF1B)
			kinesin light chain 1 (KLC1)
			kinesin light chain 3 (KLC3)
			kynurenine 3-monooxygenase (KMO)
			laccase domain containing 1 (LACC1)
			lactamase beta (LACTB)
			leucine rich pentatricopeptide repeat containing (LRPPRC)
			leucine rich repeat kinase 2 (LRRK2)
			leucine zipper and EF-hand containing transmembrane protein 1 (LETM1)
			leucyl-tRNA synthetase 2, mitochondrial (LARS2)
			lipoic acid synthetase (LIAS)
			lipoyl(octanoyl) transferase 2 (LIPT2)
			lon peptidase 1, mitochondrial (LONP1)
			malate dehydrogenase 1 (MDH1)
			malate dehydrogenase 2 (MDH2)
			malic enzyme 2 (ME2)
			malic enzyme 3 (ME3)
			malonyl-CoA decarboxylase (MLYCD)
			malonyl-CoA-acyl carrier protein transacylase (MCAT)
			membrane associated ring-CH-type finger 5 (MARCH5)
			mercaptopyruvate sulfurtransferase (MPST)
			metaxin 2 (MTX2)
			methionine sulfoxide reductase B3 (MSRB3)
			methionyl aminopeptidase type 1D, mitochondrial (METAP1D)
			methionyl-tRNA synthetase 2, mitochondrial (MARS2)
			methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like (MTHFD1L)
			methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase (MTHFD2)
			methylmalonic aciduria (cobalamin deficiency) cblA type (MMAA)
			methylmalonic aciduria and homocystinuria, cblD type (MMADHC)
			methylmalonyl-CoA mutase (MUT)
			microsomal glutathione S-transferase 1 (MGST1)
			microtubule associated scaffold protein 1 (MTUS1)
			mitochondrial amidoxime reducing component 2 (MARC2)
			mitochondrial calcium uniporter (MCU)
			mitochondrial calcium uptake 1 (MICU1)
			mitochondrial carrier 1 (MTCH1)
			mitochondrial carrier 2 (MTCH2)
			mitochondrial elongation factor 2 (MIEF2)
			mitochondrial fission factor (MFF)
			mitochondrial fission process 1 (MTFP1)
			mitochondrial fission regulator 1 (MTFR1)
			mitochondrial genome maintenance exonuclease 1 (MGME1)
			mitochondrial intermediate peptidase (MIPEP)
			mitochondrial methionyl-tRNA formyltransferase (MTFMT)
			mitochondrial poly(A) polymerase (MTPAP)
			mitochondrial pyruvate carrier 1 (MPC1)
			mitochondrial rRNA methyltransferase 3 (MRM3)
			mitochondrial ribosomal protein L1 (MRPL1)
			mitochondrial ribosomal protein L10 (MRPL10)
			mitochondrial ribosomal protein L12 (MRPL12)
			mitochondrial ribosomal protein L13 (MRPL13)
			mitochondrial ribosomal protein L14 (MRPL14)
			mitochondrial ribosomal protein L15 (MRPL15)
			mitochondrial ribosomal protein L16 (MRPL16)
			mitochondrial ribosomal protein L17 (MRPL17)
			mitochondrial ribosomal protein L18 (MRPL18)
			mitochondrial ribosomal protein L19 (MRPL19)
			mitochondrial ribosomal protein L2 (MRPL2)
			mitochondrial ribosomal protein L20 (MRPL20)
			mitochondrial ribosomal protein L21 (MRPL21)
			mitochondrial ribosomal protein L22 (MRPL22)
			mitochondrial ribosomal protein L23 (MRPL23)
			mitochondrial ribosomal protein L24 (MRPL24)
			mitochondrial ribosomal protein L27 (MRPL27)
			mitochondrial ribosomal protein L28 (MRPL28)
			mitochondrial ribosomal protein L3 (MRPL3)
			mitochondrial ribosomal protein L30 (MRPL30)
			mitochondrial ribosomal protein L32 (MRPL32)
			mitochondrial ribosomal protein L33 (MRPL33)
			mitochondrial ribosomal protein L34 (MRPL34)
			mitochondrial ribosomal protein L35 (MRPL35)
			mitochondrial ribosomal protein L36 (MRPL36)
			mitochondrial ribosomal protein L37 (MRPL37)
			mitochondrial ribosomal protein L38 (MRPL38)
			mitochondrial ribosomal protein L39 (MRPL39)
			mitochondrial ribosomal protein L4 (MRPL4)
			mitochondrial ribosomal protein L40 (MRPL40)
			mitochondrial ribosomal protein L41 (MRPL41)
			mitochondrial ribosomal protein L42 (MRPL42)
			mitochondrial ribosomal protein L43 (MRPL43)
			mitochondrial ribosomal protein L44 (MRPL44)
			mitochondrial ribosomal protein L45 (MRPL45)
			mitochondrial ribosomal protein L46 (MRPL46)
			mitochondrial ribosomal protein L47 (MRPL47)
			mitochondrial ribosomal protein L48 (MRPL48)
			mitochondrial ribosomal protein L49 (MRPL49)
			mitochondrial ribosomal protein L50 (MRPL50)
			mitochondrial ribosomal protein L51 (MRPL51)
			mitochondrial ribosomal protein L52 (MRPL52)
			mitochondrial ribosomal protein L53 (MRPL53)
			mitochondrial ribosomal protein L54 (MRPL54)
			mitochondrial ribosomal protein L55 (MRPL55)
			mitochondrial ribosomal protein L57 (MRPL57)
			mitochondrial ribosomal protein L58 (MRPL58)
			mitochondrial ribosomal protein L9 (MRPL9)
			mitochondrial ribosomal protein S10 (MRPS10)
			mitochondrial ribosomal protein S11 (MRPS11)
			mitochondrial ribosomal protein S12 (MRPS12)
			mitochondrial ribosomal protein S14 (MRPS14)
			mitochondrial ribosomal protein S15 (MRPS15)
			mitochondrial ribosomal protein S16 (MRPS16)
			mitochondrial ribosomal protein S17 (MRPS17)
			mitochondrial ribosomal protein S18A (MRPS18A)
			mitochondrial ribosomal protein S18B (MRPS18B)
			mitochondrial ribosomal protein S18C (MRPS18C)
			mitochondrial ribosomal protein S2 (MRPS2)
			mitochondrial ribosomal protein S21 (MRPS21)
			mitochondrial ribosomal protein S22 (MRPS22)
			mitochondrial ribosomal protein S23 (MRPS23)
			mitochondrial ribosomal protein S24 (MRPS24)
			mitochondrial ribosomal protein S25 (MRPS25)
			mitochondrial ribosomal protein S26 (MRPS26)
			mitochondrial ribosomal protein S27 (MRPS27)
			mitochondrial ribosomal protein S28 (MRPS28)
			mitochondrial ribosomal protein S30 (MRPS30)
			mitochondrial ribosomal protein S31 (MRPS31)
			mitochondrial ribosomal protein S33 (MRPS33)
			mitochondrial ribosomal protein S34 (MRPS34)
			mitochondrial ribosomal protein S35 (MRPS35)
			mitochondrial ribosomal protein S36 (MRPS36)
			mitochondrial ribosomal protein S5 (MRPS5)
			mitochondrial ribosomal protein S6 (MRPS6)
			mitochondrial ribosomal protein S7 (MRPS7)
			mitochondrial ribosomal protein S9 (MRPS9)
			mitochondrial ribosome recycling factor (MRRF)
			mitochondrial tRNA translation optimization 1 (MTO1)
			mitochondrial trans-2-enoyl-CoA reductase (MECR)
			mitochondrial transcription termination factor 1 (MTERF1)
			mitochondrial translation release factor 1 (MTRF1)
			mitochondrial translational initiation factor 2 (MTIF2)
			mitochondrial translational initiation factor 3 (MTIF3)
			mitochondrial translational release factor 1 like (MTRF1L)
			mitochondrially encoded 12S RNA (MT-RNR1)
			mitochondrially encoded 16S RNA (MT-RNR2)
			mitochondrially encoded NADH 4L dehydrogenase (MT-ND4L)
			mitochondrially encoded NADH dehydrogenase 1 (MT-ND1)
			mitochondrially encoded NADH dehydrogenase 2 (MT-ND2)
			mitochondrially encoded NADH dehydrogenase 3 (MT-ND3)
			mitochondrially encoded NADH dehydrogenase 4 (MT-ND4)
			mitochondrially encoded NADH dehydrogenase 5 (MT-ND5)
			mitochondrially encoded NADH dehydrogenase 6 (MT-ND6)
			mitochondrially encoded cytochrome b (MT-CYB)
			mitochondrially encoded cytochrome c oxidase I (MT-CO1)
			mitochondrially encoded cytochrome c oxidase II (MT-CO2)
			mitochondrially encoded cytochrome c oxidase III (MT-CO3)
			mitochondrially encoded tRNA alanine (MT-TA)
			mitochondrially encoded tRNA arginine (MT-TR)
			mitochondrially encoded tRNA asparagine (MT-TN)
			mitochondrially encoded tRNA aspartic acid (MT-TD)
			mitochondrially encoded tRNA cysteine (MT-TC)
			mitochondrially encoded tRNA glutamic acid (MT-TE)
			mitochondrially encoded tRNA glutamine (MT-TQ)
			mitochondrially encoded tRNA glycine (MT-TG)
			mitochondrially encoded tRNA histidine (MT-TH)
			mitochondrially encoded tRNA isoleucine (MT-TI)
			mitochondrially encoded tRNA leucine 1 (UUA/G) (MT-TL1)
			mitochondrially encoded tRNA leucine 2 (CUN) (MT-TL2)
			mitochondrially encoded tRNA lysine (MT-TK)
			mitochondrially encoded tRNA methionine (MT-TM)
			mitochondrially encoded tRNA phenylalanine (MT-TF)
			mitochondrially encoded tRNA proline (MT-TP)
			mitochondrially encoded tRNA serine 1 (UCN) (MT-TS1)
			mitochondrially encoded tRNA serine 2 (AGU/C) (MT-TS2)
			mitochondrially encoded tRNA threonine (MT-TT)
			mitochondrially encoded tRNA tryptophan (MT-TW)
			mitochondrially encoded tRNA tyrosine (MT-TY)
			mitochondrially encoded tRNA valine (MT-TV)
			mitofusin 1 (MFN1)
			mitofusin 2 (MFN2)
			monoamine oxidase A (MAOA)
			monoamine oxidase B (MAOB)
			mutY DNA glycosylase (MUTYH)
			nicotinamide nucleotide adenylyltransferase 3 (NMNAT3)
			nicotinamide nucleotide transhydrogenase (NNT)
			nipsnap homolog 1 (NIPSNAP1)
			nipsnap homolog 2 (NIPSNAP2)
			nitric oxide associated 1 (NOA1)
			nuclear receptor subfamily 4 group A member 1 (NR4A1)
			nuclear respiratory factor 1 (NRF1)
			nucleotide binding protein like (NUBPL)
			nudix hydrolase 1 (NUDT1)
			ornithine aminotransferase (OAT)
			ornithine carbamoyltransferase (OTC)
			oxidative stress induced growth inhibitor 1 (OSGIN1)
			oxoglutarate dehydrogenase (OGDH)
			oxoglutarate dehydrogenase like (OGDHL)
			pantothenate kinase 2 (PANK2)
			patatin like phospholipase domain containing 8 (PNPLA8)
			pentatricopeptide repeat domain 1 (PTCD1)
			peptidase, mitochondrial processing alpha subunit (PMPCA)
			peptidase, mitochondrial processing beta subunit (PMPCB)
			peptide deformylase, mitochondrial (PDF)
			peptidyl-tRNA hydrolase 2 (PTRH2)
			peptidylprolyl cis/trans isomerase, NIMA-interacting 4 (PIN4)
			peptidylprolyl isomerase F (PPIF)
			peroxiredoxin 3 (PRDX3)
			peroxiredoxin 5 (PRDX5)
			peroxisome proliferator-activated receptor gamma, coactivator-related 1 (PPRC1)
			phenylalanyl-tRNA synthetase 2, mitochondrial (FARS2)
			phosphatase and tensin homolog (PTEN)
			phosphatidylethanolamine N-methyltransferase (PEMT)
			phosphatidylserine decarboxylase (PISD)
			phosphatidylserine synthase 1 (PTDSS1)
			phosphoenolpyruvate carboxykinase 1 (PCK1)
			phosphoenolpyruvate carboxykinase 2, mitochondrial (PCK2)
			phospholipase A2 group IVB (PLA2G4B)
			pitrilysin metallopeptidase 1 (PITRM1)
			polyribonucleotide nucleotidyltransferase 1 (PNPT1)
			presenilin associated rhomboid like (PARL)
			presequence translocase associated motor 16 (PAM16)
			proline dehydrogenase 1 (PRODH)
			proline dehydrogenase 2 (PRODH2)
			prolyl-tRNA synthetase 2, mitochondrial (PARS2)
			propionyl-CoA carboxylase subunit alpha (PCCA)
			propionyl-CoA carboxylase subunit beta (PCCB)
			protein interacting with PRKCA 1 (PICK1)
			protein phosphatase, Mg2+/Mn2+ dependent 1K (PPM1K)
			protoporphyrinogen oxidase (PPOX)
			pseudouridylate synthase 1 (PUS1)
			pyrophosphatase (inorganic) 2 (PPA2)
			pyrroline-5-carboxylate reductase 1 (PYCR1)
			pyrroline-5-carboxylate reductase 2 (PYCR2)
			pyruvate carboxylase (PC)
			pyruvate dehydrogenase E1 alpha 1 subunit (PDHA1)
			pyruvate dehydrogenase E1 beta subunit (PDHB)
			pyruvate dehydrogenase complex component X (PDHX)
			pyruvate dehydrogenase kinase 1 (PDK1)
			pyruvate dehydrogenase kinase 2 (PDK2)
			pyruvate dehydrogenase kinase 3 (PDK3)
			pyruvate dehydrogenase kinase 4 (PDK4)
			pyruvate dehyrogenase phosphatase catalytic subunit 1 (PDP1)
			pyruvate dehyrogenase phosphatase catalytic subunit 2 (PDP2)
			ras homolog family member T2 (RHOT2)
			reactive oxygen species modulator 1 (ROMO1)
			receptor accessory protein 1 (REEP1)
			required for meiotic nuclear division 1 homolog (RMND1)
			reticulon 4 interacting protein 1 (RTN4IP1)
			retinol dehydrogenase 13 (RDH13)
			ribonuclease H1 (RNASEH1)
			ribonucleotide reductase regulatory TP53 inducible subunit M2B (RRM2B)
			ribosomal protein S6 kinase C1 (RPS6KC1)
			sarcosine dehydrogenase (SARDH)
			selenoprotein H (SELENOH)
			selenoprotein O (SELENOO)
			septin 4 (SEPT4)
			serine active site containing 1 (SERAC1)
			serine hydroxymethyltransferase 2 (SHMT2)
			seryl-tRNA synthetase 2, mitochondrial (SARS2)
			sideroflexin 4 (SFXN4)
			single stranded DNA binding protein 1 (SSBP1)
			single-pass membrane protein with aspartate rich tail 1 (SMDT1)
			solute carrier family 25 member 1 (SLC25A1)
			solute carrier family 25 member 10 (SLC25A10)
			solute carrier family 25 member 11 (SLC25A11)
			solute carrier family 25 member 12 (SLC25A12)
			solute carrier family 25 member 13 (SLC25A13)
			solute carrier family 25 member 14 (SLC25A14)
			solute carrier family 25 member 15 (SLC25A15)
			solute carrier family 25 member 16 (SLC25A16)
			solute carrier family 25 member 17 (SLC25A17)
			solute carrier family 25 member 19 (SLC25A19)
			solute carrier family 25 member 2 (SLC25A2)
			solute carrier family 25 member 20 (SLC25A20)
			solute carrier family 25 member 21 (SLC25A21)
			solute carrier family 25 member 22 (SLC25A22)
			solute carrier family 25 member 25 (SLC25A25)
			solute carrier family 25 member 26 (SLC25A26)
			solute carrier family 25 member 27 (SLC25A27)
			solute carrier family 25 member 29 (SLC25A29)
			solute carrier family 25 member 3 (SLC25A3)
			solute carrier family 25 member 30 (SLC25A30)
			solute carrier family 25 member 31 (SLC25A31)
			solute carrier family 25 member 32 (SLC25A32)
			solute carrier family 25 member 33 (SLC25A33)
			solute carrier family 25 member 34 (SLC25A34)
			solute carrier family 25 member 35 (SLC25A35)
			solute carrier family 25 member 37 (SLC25A37)
			solute carrier family 25 member 38 (SLC25A38)
			solute carrier family 25 member 39 (SLC25A39)
			solute carrier family 25 member 4 (SLC25A4)
			solute carrier family 25 member 40 (SLC25A40)
			solute carrier family 25 member 41 (SLC25A41)
			solute carrier family 25 member 42 (SLC25A42)
			solute carrier family 25 member 43 (SLC25A43)
			solute carrier family 25 member 44 (SLC25A44)
			solute carrier family 25 member 45 (SLC25A45)
			solute carrier family 25 member 46 (SLC25A46)
			solute carrier family 25 member 47 (SLC25A47)
			solute carrier family 25 member 5 (SLC25A5)
			solute carrier family 25 member 52 (SLC25A52)
			solute carrier family 25 member 6 (SLC25A6)
			solute carrier family 27 member 2 (SLC27A2)
			solute carrier family 29 member 1 (Augustine blood group) (SLC29A1)
			solute carrier family 39 member 8 (SLC39A8)
			solute carrier family 9 member B2 (SLC9B2)
			spartin (SPART)
			sperm mitochondria associated cysteine rich protein (SMCP)
			spermatogenesis associated 18 (SPATA18)
			spermatogenesis associated 5 (SPATA5)
			steroidogenic acute regulatory protein (STAR)
			succinate dehydrogenase complex assembly factor 1 (SDHAF1)
			succinate dehydrogenase complex assembly factor 2 (SDHAF2)
			succinate dehydrogenase complex flavoprotein subunit A (SDHA)
			succinate dehydrogenase complex iron sulfur subunit B (SDHB)
			succinate dehydrogenase complex subunit C (SDHC)
			succinate dehydrogenase complex subunit D (SDHD)
			succinate-CoA ligase ADP-forming beta subunit (SUCLA2)
			succinate-CoA ligase alpha subunit (SUCLG1)
			sulfide quinone oxidoreductase (SQOR)
			sulfite oxidase (SUOX)
			superoxide dismutase 1 (SOD1)
			superoxide dismutase 2 (SOD2)
			tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase (TRMU)
			tRNA isopentenyltransferase 1 (TRIT1)
			tRNA methyltransferase 10C, mitochondrial RNase P subunit (TRMT10C)
			tRNA-histidine guanylyltransferase 1 like (THG1L)
			tectonin beta-propeller repeat containing 1 (TECPR1)
			tetraspanin 6 (TSPAN6)
			tetratricopeptide repeat domain 19 (TTC19)
			thioredoxin 2 (TXN2)
			thioredoxin reductase 2 (TXNRD2)
			thioredoxin related transmembrane protein 2 (TMX2)
			thiosulfate sulfurtransferase (TST)
			threonyl-tRNA synthetase 2, mitochondrial (TARS2)
			thymidine kinase 2, mitochondrial (TK2)
			thymidine phosphorylase (TYMP)
			thymidylate synthetase (TYMS)
			transcription factor A, mitochondrial (TFAM)
			transcription factor B1, mitochondrial (TFB1M)
			translational activator of cytochrome c oxidase I (TACO1)
			translocase of inner mitochondrial membrane 10 (TIMM10)
			translocase of inner mitochondrial membrane 10B (TIMM10B)
			translocase of inner mitochondrial membrane 13 (TIMM13)
			translocase of inner mitochondrial membrane 17B (TIMM17B)
			translocase of inner mitochondrial membrane 22 (TIMM22)
			translocase of inner mitochondrial membrane 23 (TIMM23)
			translocase of inner mitochondrial membrane 44 (TIMM44)
			translocase of inner mitochondrial membrane 50 (TIMM50)
			translocase of inner mitochondrial membrane 8 homolog B (TIMM8B)
			translocase of inner mitochondrial membrane 8A (TIMM8A)
			translocase of inner mitochondrial membrane 9 (TIMM9)
			translocase of outer mitochondrial membrane 22 (TOMM22)
			translocase of outer mitochondrial membrane 34 (TOMM34)
			translocase of outer mitochondrial membrane 40 (TOMM40)
			translocase of outer mitochondrial membrane 7 (TOMM7)
			translocase of outer mitochondrial membrane 70 (TOMM70)
			translocator protein (TSPO)
			transmembrane protein 126A (TMEM126A)
			transmembrane protein 126B (TMEM126B)
			transmembrane protein 70 (TMEM70)
			transport and golgi organization 2 homolog (TANGO2)
			trimethyllysine hydroxylase, epsilon (TMLHE)
			tryptophanyl tRNA synthetase 2, mitochondrial (WARS2)
			tryptophanyl-tRNA synthetase (WARS)
			tumor protein p53 regulated apoptosis inducing protein 1 (TP53AIP1)
			twinkle mtDNA helicase (TWNK)
			tyrosine aminotransferase (TAT)
			tyrosyl-tRNA synthetase 2 (YARS2)
			ubiquinol-cytochrome c reductase binding protein (UQCRB)
			ubiquinol-cytochrome c reductase complex III subunit VII (UQCRQ)
			ubiquinol-cytochrome c reductase complex assembly factor 2 (UQCC2)
			ubiquinol-cytochrome c reductase complex assembly factor 3 (UQCC3)
			ubiquinol-cytochrome c reductase core protein 2 (UQCRC2)
			ubiquinol-cytochrome c reductase, complex III subunit X (UQCR10)
			ubiquinol-cytochrome c reductase, complex III subunit XI (UQCR11)
			ubiquitin specific peptidase 30 (USP30)
			ubiquitin specific peptidase 35 (USP35)
			uncoupling protein 1 (UCP1)
			uncoupling protein 2 (UCP2)
			uncoupling protein 3 (UCP3)
			uracil DNA glycosylase (UNG)
			valyl-tRNA synthetase 2, mitochondrial (VARS2)
			vascular endothelial growth factor B (VEGFB)
			voltage dependent anion channel 1 (VDAC1)
			voltage dependent anion channel 1 pseudogene 4 (VDAC1P4)
			voltage dependent anion channel 2 (VDAC2)
			voltage dependent anion channel 3 (VDAC3)

			PubMed Journals
			Mitochondrial DNA 920 Articles
			Mitochondrial DNA A DNA Mapp Seq Anal 2316 Articles
			Mitochondrial DNA B Resour 7 Articles
			Mitochondrion 1290 Articles

     		                         Embed       Tweet